According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry?

Authors

  • Tahir ÖLMEZ Selçuk University, Social Sciences Dept., Selcuklu/Konya,

Keywords:

Quantum Perspective Model, Danio Rerio, Pi numbers, NCBI (National Biotechnology Information Center), Timema

Abstract

This article researches whether there is a link between pi numbers and genetic codes. At first, the digits of the pi numbers after the comma are added respectively. Then, the sum of the numbers after the comma are converted to bases in genetic codes. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (A, T, C, G, and U). (A)Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first four hundred digits of pi numbers after the comma are calculated [1], the gene sequence is obtained as follows: [TCGATTATACTGGTTGGTTGTTAACGGTAC]. Thirdly, after NCBI (National Biotechnology Information Center) has researched this sequence, the search result is similar to DANIO RERIO (Zebra fish) and even Timema. Fourthly, fish containing Arginine “CGG”, one of the results of the NCBI blasts, is also an example of Zebra fish, a species of bony fish. Zebra fish and human genetic codes have been proven to be very similar to each other. Fifthly, while pi, one of the irrational numbers, should be a non-repetitive sequence, some repetitive gene sequences were found after investigating this sequence [TCGATTATACTGGTTGGTTGTTAACGGTAC] at the NCBI (National Biotechnology Information Center). Just like “TTA”,”TAC” and” GTT”. “Finally, given that Timemas reproduce asexually, not only are the pi numbers irrational numbers, but there is also an abnormal sexual reproduction in Timema. In summary, the relationship between pi numbers and genetic codes can also help in obtaining new clues in Biochemistry.

References

. http://www.math.com/tables/constants/pi.htm January 2021.

. https://www.wikizero.com/en/SgRNA January 2021.

. Köklü K. Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology April 2019b; 17:3. DOI: 10.14704/nq.2019.17.3.1999.

. Köklü K. A Quantum Perspective Model to Genetic Codes through Various Sciences. Neuroquantology April 2019a; Vol 17.No:3. DOI: 10.14704/nq.2019.17.3.1974

. Lodish H, Berk A, Zipursky S L, Matsudaira P, Baltimore D and Darnell J. Molecular Cell Biology, 6th edition, Translation: Geçkil H, Özmen M, Yeşilada Ö, Palme Publishing, New York, 2018, 294-302

. Ölmez T.Is there an aesthetics in golden ratio as regards to the common cis-regulatory elements versus to atomic numbers of elements with respect to Quantum perspective model? Neurology and Neuroscience Reports 2020; Vol.3.DOI: 10.15761/NNR.1000119

. Ölmez T. With respect to Quantum perspective model, Can Euler Numbers be related to Biochemistry? Global Journal of Science Frontier Research 2020; Vol.20, Issue: 9.

. Ölmez T. Is there a similarity between Fibonacci sequence and Euler’s number with respect to quantum perspective model? Global Journal of Science Frontier Research 2020; Vol.20, Issue: 9

. https://ipfs.io/ipfs/QmXoypizjW3WknFi-JnKLwHCnL72vedxjQkDDP1mXWo6uco/wiki/ Zebrafish.html January 2021.

. Wieser E M, Holden N, Coplen B T, Böhlke J K, Berglund M and Brand W A and et al. Atomic weights of the elements 2011, Pure and Application Chemistry 2013; 85(5): 1047-1078

. Farrell RE (2010) RNA Methodologies A Laboratory Guide For Isolation and Characterization, 4th Edition, Amsterdam Elsevier Acad Press, The Pennsylvania State University York pp. 704-710.

. https://en.wikipedia.org/wiki/Timema 14 December 2020 December 2020.

. Schwander, Tanja; Lee Henry; Bernard J Crespi (2011). "Molecular evidence for ancient asexuality in Timema stick insects". Current Biology. 21 (13): 1129–34. Doi :10.1016/j.cub.2011.05.026

. https://blast.ncbi.nlm.nih.gov/Blast.cgi January 2021.

. Nirenberg M, Leder P, Bernfield M, Brimacombe R, Trupin J,Rottman F, O’Neal C. NA Codewords and Protein Synthesis.VII on the General Nature of the RNA Code. Proc Natl Acad. Sci, USA. 1965; 53(5): 1161-1168

. Gad M.Z. Anti-aging effects of l-arginine, Journal of Advanced Research (2010)1, 169–177.Doi: https://doi.org/10.1016/j.jare.2010.05.001.

. Seyyed Morteza Hoseini, Mukhtar Ahmad Khan, Morteza Yousefi and Benjamin Costas, Roles of arginine in fish nutrition and health: insights for future researches, Reviews in Aquaculture Vol:12.Issue:4,November 2020,pages :2091-2108,doi: https://doi.org/10.1111/raq.12424.

. Kurnaz M L, Bilgin T. and Kurnaz I.A. A Statistical Analysis of the Robustness of Alternate Genetic Coding Tables, Int. J. Mol. Sci. 2008, 9, 679-697. doi: 10,3390/ijms9050679 ·

. https://en.wikipedia.org/wiki/Arginine 02 January 2021 January 2021.

Downloads

Published

2021-10-03

Issue

Section

Articles

How to Cite

ÖLMEZ, T. . (2021). According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry?. International Journal of Natural Sciences: Current and Future Research Trends , 11(1), 1-10. https://ijnscfrtjournal.isrra.org/Natural_Sciences_Journal/article/view/1035