According to Quantum Perspective Model, Is Euler’s Identity also Meaningful in Biochemistry?

Authors

  • Tahir ÖLMEZ Selçuk University, Social Sciences Dept., Selcuklu/Konya,

Keywords:

Quantum Perspective Model, Danio Rerio, Euler's identity, NCBI (National Biotechnology Information Center), Timema

Abstract

According to Quantum Perspective Model, this article researches whether there is a link between the Euler's identity and the genetic sequences. At first, Euler's identity is squared (See Figure-1). Then, the digits of pi number after the comma are sequenced "TCGATTATACTGGTTGGTTTTAACGGTAC"[18]. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (A, T, C, G, and U). (A)Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, the reason pi number’s sequence is written twice is because Euler's identity is squared. Then, add Euler's nucleotide bases [7] to this gene sequence respectively, the result is obtained by:[AAAGGUCCGUUUAAUAAGUUAAAUUUAGGU].Thirdly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to Danio Rerio (Zebra fish),Danio Kyathit and even Timema. Fourthly, the genetic codes of Zebra fish have been proven to be very similar to human genetic codes. Lastly, Even Timema reproduces asexually. As a result, Euler's identity is not only related to irrational numbers in Mathematics, but also to genetic codes in Biochemistry.

References

. https://en.wikipedia.org/wiki/Euler%27s_identity January 2021.

. https://en.wikipedia.org/wiki/Hypercomplex_number January 2021.

. Köklü K. Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology April 2019b; 17:3. DOI: 10.14704/nq.2019.17.3.1999.

. Köklü K. A Quantum Perspective Model to Genetic Codes through Various Sciences. Neuroquantology April 2019a; Vol 17.No:3. DOI: 10.14704/nq.2019.17.3.1974

. Lodish H, Berk A, Zipursky S L, Matsudaira P, Baltimore D and Darnell J. Molecular Cell Biology, 6th edition, Translation: Geçkil H, Özmen M, Yeşilada Ö, Palme Publishing, New York, 2018, 294-302

. Ölmez T.Is there an aesthetics in golden ratio as regards to the common cis-regulatory elements versus to atomic numbers of elements with respect to Quantum perspective model? Neurology and Neuroscience Reports 2020; Vol.3.DOI: 10.15761/NNR.1000119

. Ölmez T. With respect to Quantum perspective model, Can Euler Numbers be related to Biochemistry? Global Journal of Science Frontier Research 2020; Vol.20, Issue: 9.

. https://ipfs.io/ipfs/QmXoypizjW3WknFi-JnKLwHCnL72vedxjQkDDP1mXWo6uco/wiki/Zebrafish.html January 2021.

. Wieser E M, Holden N, Coplen B T, Böhlke J K, Berglund M and Brand W A and et al. Atomic weights of the elements 2011, Pure and Application Chemistry 2013; 85(5): 1047-1078

. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3353008 January 2021.

. https://en.wikipedia.org/wiki/Timema January 2021.

. Schwander, Tanja; Lee Henry; Bernard J Crespi (2011). "Molecular evidence for ancient asexuality in Timema stick insects". Current Biology. 21 (13): 1129–34. Doi:10.1016/j.cub.2011.05.026

. https://blast.ncbi.nlm.nih.gov/Blast.cgi January 2021.

. Nirenberg M, Leder P, Bernfield M, Brimacombe R, Trupin J,Rottman F, O’Neal C. NA Codewords and Protein Synthesis.VII on the General Nature of the RNA Code. Proc Natl Acad. Sci, USA. 1965; 53(5): 1161-1168

. https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables January 2021.

. Nebb K.Hermann and Olafsson Gestur, Reflection Positivity: A Representation Theoretic Perspective, Springer Briefs in Mathematical Physics, Springer Cham Publisher, and 2018.p.1.

. https://www.wikizero.com/en/SgRNA January 2021.

. Ölmez T, According to Quantum Perspective Model, Are the numbers of Pi also meaningful in Biochemistry? January 2021 (Unpublished).

Downloads

Published

2021-10-03

Issue

Section

Articles

How to Cite

ÖLMEZ, T. . (2021). According to Quantum Perspective Model, Is Euler’s Identity also Meaningful in Biochemistry?. International Journal of Natural Sciences: Current and Future Research Trends , 9(01), 23-28. https://ijnscfrtjournal.isrra.org/Natural_Sciences_Journal/article/view/1037