According to Quantum Perspective Model, Is Euler’s Identity also Meaningful in Biochemistry?

Abstract

According to Quantum Perspective Model, this article researches whether there is a link between the Euler's identity and the genetic sequences. At first, Euler's identity is squared (See Figure-1). Then, the digits of pi number after the comma are sequenced "TCGATTATACTGGTTGGTTTTAACGGTAC"[18]. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (A, T, C, G, and U). (A)Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, the reason pi number’s sequence is written twice is because Euler's identity is squared. Then, add Euler's nucleotide bases [7] to this gene sequence respectively, the result is obtained by:[AAAGGUCCGUUUAAUAAGUUAAAUUUAGGU].Thirdly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to Danio Rerio (Zebra fish),Danio Kyathit and even Timema. Fourthly, the genetic codes of Zebra fish have been proven to be very similar to human genetic codes. Lastly, Even Timema reproduces asexually. As a result, Euler's identity is not only related to irrational numbers in Mathematics, but also to genetic codes in Biochemistry.