According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry?

Abstract

This article researches whether there is a link between pi numbers and genetic codes. At first, the digits of the pi numbers after the comma are added respectively. Then, the sum of the numbers after the comma are converted to bases in genetic codes. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (A, T, C, G, and U). (A)Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first four hundred digits of pi numbers after the comma are calculated [1], the gene sequence is obtained as follows: [TCGATTATACTGGTTGGTTGTTAACGGTAC]. Thirdly, after NCBI (National Biotechnology Information Center) has researched this sequence, the search result is similar to DANIO RERIO (Zebra fish) and even Timema. Fourthly, fish containing Arginine “CGG”, one of the results of the NCBI blasts, is also an example of Zebra fish, a species of bony fish. Zebra fish and human genetic codes have been proven to be very similar to each other. Fifthly, while pi, one of the irrational numbers, should be a non-repetitive sequence, some repetitive gene sequences were found after investigating this sequence [TCGATTATACTGGTTGGTTGTTAACGGTAC] at the NCBI (National Biotechnology Information Center). Just like “TTA”,”TAC” and” GTT”. “Finally, given that Timemas reproduce asexually, not only are the pi numbers irrational numbers, but there is also an abnormal sexual reproduction in Timema. In summary, the relationship between pi numbers and genetic codes can also help in obtaining new clues in Biochemistry.