International Journal of Natural Sciences: Current and Future Research Trends <p style="text-align: justify;">The International Journal of Social Sciences: Current and Future Research Trends (IJSSCFRT) is an open access International Journal for scientists and researchers to publish their scientific papers in Social Sciences related fields. IJSSCFRT plays its role as a refereed international journal to publish research results conducted by researchers.</p> <p>This journal accepts scientific papers for publication after passing the journal's double&nbsp;peer review process.&nbsp; For detailed information about the journal kindly check <a title="About the Journal" href="">About the Journal</a>&nbsp;page.&nbsp;</p> <p style="text-align: justify;">All IJSSCFRT published papers in Social Sciences will be available for scientific readers for free; no fees are required to download published papers in this international journal.</p> <p style="text-align: justify;">&nbsp;</p> en-US <p>Authors who submit papers&nbsp;with this journal agree to the following terms:</p> <ol start="1"> <li>Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a&nbsp;<a href="" target="_new">Creative Commons Attribution License</a>&nbsp;that allows others to share the work with an acknowledgement of the work's authorship and initial publication in this journal.</li> <li>Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal.</li> <li>Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work (See&nbsp;<a href="" target="_new">The Effect of Open Access</a>).</li> <li>By submitting the processing fee, it is understood that the author has agreed to our terms and conditions which may change from time to time without any notice.</li> <li>It should be clear for authors that the Editor In Chief is responsible for the final decision about the submitted papers; have the right to accept\reject any paper. &nbsp;The Editor In Chief will choose any option from the following to review the submitted papers:A. send the paper to two reviewers, if the results were negative by one reviewer and positive by the other one; then the editor may send the paper for third reviewer or he take immediately the final decision by accepting\rejecting the paper. The Editor In Chief will ask the selected reviewers to present the results within 7 working days, if they were unable to complete the review within the agreed period then the editor have the right to resend the papers for new reviewers using the same procedure. If the Editor In Chief was not able to find suitable reviewers for certain papers then he have the right to reject the paper.</li> <li>Author will take the responsibility what so ever if any copyright infringement or any other violation of any law is done by publishing the research work by the author</li> <li>Before publishing, author must check whether this journal is accepted by his employer, or any authority he intends to submit his research work. we will not be responsible in this matter.</li> <li>If at any time, due to any legal reason, if the journal stops accepting manuscripts or could not publish already accepted manuscripts, we will have the right to cancel all or any one of the manuscripts without any compensation or returning back any kind of processing cost.</li> <li>The cost covered in the publication fees is only for online publication of a single manuscript.</li> </ol> (Majed O. A. Masagba) (Laras Lestari) Sat, 02 Oct 2021 16:14:46 +0000 OJS 60 According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry? <p>This article researches whether there is a link between pi numbers and genetic codes. At first, the digits of the pi numbers after the comma are added respectively. Then, the sum of the numbers after the comma are converted to bases in genetic codes. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (<strong>A, </strong><strong>T, C, G, and U</strong>). (<strong>A</strong>)Adenine, (<strong>T)</strong> Thymine, (<strong>C</strong>) Cytosine, (<strong>G</strong>) Guanine, (<strong>U</strong>)<strong> Uracil</strong>. From this point of view, when the first four hundred digits of pi numbers after the comma are calculated [1], the gene sequence is obtained as follows: [<strong>TCGATTATACTGGTTGGTTGTTAACGGTAC</strong>]. Thirdly, after NCBI (National Biotechnology Information Center) has researched this sequence, the search result is similar to <strong>DANIO RERIO (Zebra fish)</strong> and even <strong>Timema</strong>. Fourthly, fish containing Arginine “CGG”, one of the results of the NCBI blasts, is also an example of Zebra fish, a species of bony fish. Zebra fish and human genetic codes have been proven to be very similar to each other. Fifthly, while pi, one of the irrational numbers, should be a non-repetitive sequence, some repetitive gene sequences were found after investigating this sequence<strong> [</strong>TCGA<strong>TTA</strong>TACTGGTTGGTTG<strong>TTA</strong>ACGGTAC] at the NCBI (National Biotechnology Information Center). Just like “<strong>TTA</strong>”,”<strong>TAC</strong>” and” <strong>GTT</strong>”. “Finally, given that Timemas reproduce asexually, not only are the pi numbers irrational numbers, but there is also an abnormal sexual reproduction in Timema. In summary, the relationship between pi numbers and genetic codes can also help in obtaining new clues in Biochemistry.</p> Tahir ÖLMEZ Copyright (c) 2021 International Scientific Research and Researchers Association (ISRRA) Sun, 03 Oct 2021 12:57:53 +0000 Continuing Pharmaceutical Education: The Extent of the Conviction and Applicability in the Palestinian Pharmaceutical Community <p>Pharmacists very often make decisions that affect patient outcomes. Studies have indicated that they have access to limited sources of information. Maintaining a good professional practice is very important especially in the health care section and this could be achieved in various ways and many steps, one of them being up-to-date with the latest scientific researches by continuous education. Therefore, structured continuing pharmaceutical education (CPE) is necessary to improve their standards and attitudes. In this study, we aimed to find the extent of the conviction and applicability of continuous education in the Palestinian Pharmaceutical community and to identify the most important topics and program for CPE as well as the most significant barriers of conducting CPE successfully.&nbsp; Thus, a cross-sectional study was conducted using an online questionnaire. The survey was designed to measure the extent of the conviction and applicability of continuing Pharmaceutical education in the Palestinian pharmaceutical community. The study included pharmacists who currently practicing pharmacy in either a community pharmacy or a health care setting or retired; from all governorates in Palestine. Some Pharmacy students participated in this study too. All data were collected between February and April 2020. SPSS version 26 was used to analyze the data collected. Three hundred seventy-three Pharmacists including the Pharmacy students (n= 71 out of 373; 19%) filled and completed the questionnaire; the majority of them worked in the private sector (n= 162; 43.4%), and 29 pharmacists (7.8%) worked in the government sector. The others either are not working (retired or students) or own their independent business. Most of the respondents (n= 235, 63%) were aware of the CPE program in America and Canada, and 268 (71.8%) didn’t know that CPE is applied in Arab countries. About 196 Pharmacists (52.5%) who participated in the study were up-to-date with the latest discoveries and recent information in the pharmacy field. Almost 360 Pharmacists (96.5%) were with the idea of applying for the CPE program in Palestine, 49.6% (n= 185) were with linking the licenses with the CPE program, and 94.9% (n= 356) think that CPE will improve their performance and profession.</p> <p>&nbsp;One hundred sixty-six Pharmacists (44.5%) preferred online lectures for the CPE program and 38.3% preferred attending the scientific seminars. The findings of this study demonstrated that the majority of Palestinian pharmacists are willing to participate in continuing pharmaceutical education programs and encourage its applicability in Palestine as this will improve their performance and profession.</p> Hatem A Hejaz, Baha Halawani, Fatima Al-Mohtaseb, Noor Abu Omar Copyright (c) 2021 International Scientific Research and Researchers Association (ISRRA) Sat, 16 Oct 2021 15:56:09 +0000