According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry?

Tahir ÖLMEZ — Sun, 03 Oct 2021 12:57:53 +0000

This article researches whether there is a link between pi numbers and genetic codes. At first, the digits of the pi numbers after the comma are added respectively. Then, the sum of the numbers after the comma are converted to bases in genetic codes. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases. (A, T, C, G, and U). (A)Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first four hundred digits of pi numbers after the comma are calculated [1], the gene sequence is obtained as follows: [TCGATTATACTGGTTGGTTGTTAACGGTAC]. Thirdly, after NCBI (National Biotechnology Information Center) has researched this sequence, the search result is similar to DANIO RERIO (Zebra fish) and even Timema. Fourthly, fish containing Arginine “CGG”, one of the results of the NCBI blasts, is also an example of Zebra fish, a species of bony fish. Zebra fish and human genetic codes have been proven to be very similar to each other. Fifthly, while pi, one of the irrational numbers, should be a non-repetitive sequence, some repetitive gene sequences were found after investigating this sequence [TCGATTATACTGGTTGGTTGTTAACGGTAC] at the NCBI (National Biotechnology Information Center). Just like “TTA”,”TAC” and” GTT”. “Finally, given that Timemas reproduce asexually, not only are the pi numbers irrational numbers, but there is also an abnormal sexual reproduction in Timema. In summary, the relationship between pi numbers and genetic codes can also help in obtaining new clues in Biochemistry.

Continuing Pharmaceutical Education: The Extent of the Conviction and Applicability in the Palestinian Pharmaceutical Community

Hatem A Hejaz, Baha Halawani, Fatima Al-Mohtaseb, Noor Abu Omar — Sat, 16 Oct 2021 15:56:09 +0000

Pharmacists very often make decisions that affect patient outcomes. Studies have indicated that they have access to limited sources of information. Maintaining a good professional practice is very important especially in the health care section and this could be achieved in various ways and many steps, one of them being up-to-date with the latest scientific researches by continuous education. Therefore, structured continuing pharmaceutical education (CPE) is necessary to improve their standards and attitudes. In this study, we aimed to find the extent of the conviction and applicability of continuous education in the Palestinian Pharmaceutical community and to identify the most important topics and program for CPE as well as the most significant barriers of conducting CPE successfully. Thus, a cross-sectional study was conducted using an online questionnaire. The survey was designed to measure the extent of the conviction and applicability of continuing Pharmaceutical education in the Palestinian pharmaceutical community. The study included pharmacists who currently practicing pharmacy in either a community pharmacy or a health care setting or retired; from all governorates in Palestine. Some Pharmacy students participated in this study too. All data were collected between February and April 2020. SPSS version 26 was used to analyze the data collected. Three hundred seventy-three Pharmacists including the Pharmacy students (n= 71 out of 373; 19%) filled and completed the questionnaire; the majority of them worked in the private sector (n= 162; 43.4%), and 29 pharmacists (7.8%) worked in the government sector. The others either are not working (retired or students) or own their independent business. Most of the respondents (n= 235, 63%) were aware of the CPE program in America and Canada, and 268 (71.8%) didn’t know that CPE is applied in Arab countries. About 196 Pharmacists (52.5%) who participated in the study were up-to-date with the latest discoveries and recent information in the pharmacy field. Almost 360 Pharmacists (96.5%) were with the idea of applying for the CPE program in Palestine, 49.6% (n= 185) were with linking the licenses with the CPE program, and 94.9% (n= 356) think that CPE will improve their performance and profession.

One hundred sixty-six Pharmacists (44.5%) preferred online lectures for the CPE program and 38.3% preferred attending the scientific seminars. The findings of this study demonstrated that the majority of Palestinian pharmacists are willing to participate in continuing pharmaceutical education programs and encourage its applicability in Palestine as this will improve their performance and profession.

International Journal of Natural Sciences: Current and Future Research Trends

According to Quantum Perspective Model, are the Numbers of Pi Also Meaningful in Biochemistry?

Continuing Pharmaceutical Education: The Extent of the Conviction and Applicability in the Palestinian Pharmaceutical Community